Journal: Cell reports

Article Title: A Landscape of Murine Long Non-Coding RNAs Reveals the Leading Transcriptome Alterations in Adipose Tissue during Aging

doi: 10.1016/j.celrep.2020.107694

Figure Lengend Snippet: (A) RNA-seq expression of RP23–218F13.7, RP24–501G17.2, and lnc-AdipoAR1 (AC116511.4) in eWAT and iWAT during aging. (B) Real-time PCR validations of RP23–218F13.7, RP24–501G17.2, and lnc-AdipoAR1 in eWAT and iWAT during aging. The expression of each gene was normalized to house-keeping gene Cyclophilin A ( CPA ). n = 5; error bars are mean ± SEM. (C) The expression of lnc-AdipoAR1 across different tissues during aging. (D) Real-time PCR analysis of lnc-AdipoAR1 during adipogenesis of 3T3-L1 adipocytes. The expression of lnc-AdipoAR1 was normalized to RPL-23 . n = 4; error bars are mean ± SEM. (E–G) lnc-AdipoAR1 was knocked down with ASOs in iWAT-derived adipocyte culture at day 0 (E), day 3 (F), or day 5 (G) during adipogenesis. RNA was harvested at indicated timing for real-time PCR to examine the expression of indicated adipocyte markers. Gene expression was normalized to RPL-23 . n = 4 (E and F) and n = 3 (G); error bars are mean ± SEM, *p < 0.05, Student’s t test.

Article Snippet: Anti-sense oligos (ASOs) (Integrated DNATechnologies) were designed to specifically target lnc-AdipoAR1.

Techniques: RNA Sequencing Assay, Expressing, Real-time Polymerase Chain Reaction, Derivative Assay

Journal: Nucleic Acids Research

Article Title: HuR protein attenuates miRNA-mediated repression by promoting miRISC dissociation from the target RNA

doi: 10.1093/nar/gks148

Figure Lengend Snippet: Oligonucleotides complementary to the spacer separating HBS and MBS sites prevent the HuR effect on miRISC cleavage in vitro . ( A ) Schemes of the HBS_50_MBSp target RNA hybridized to complementary 50-mer DNA and 27-mer LNA oligonucleotides. ( B ) Prehybridization of DNA and LNA oligonucleotides interferes with the alleviating effect of HuR on miRISC cleavage. (Upper panels) Effect of increasing concentrations of HuR on cleavage of control HBS_50_MBSp RNA or its duplexes with either DNA or LNA oligonucleotides. (Lower panel) Quantification (means ± SD; n = 3) of experiments similar to those shown in upper panels. ( C ) Prehybridization of 50-nt DNA oligonucleotide complementary to the spacer region of HBS_50_MBSp RNA interferes with HuR oligomerization along RNA as visualized by EMSA. Although comparison of the left (no oligonucleotide) and right (complementary oligonucleotide added) panels reveals the decrease in a number of HuR-associated bands in response to hybridizing the oligonucletide, the precise number and nature of HuR molecules associated with each EMSA band is difficult to assign. The IL-1β HBS element itself is 33-nt long and is likely to accommodate two HuR molecules; in addition, HuR may associate with RNA as either monomer or homodimer ( , ).

Article Snippet: Templates for generation of HBS_20_MBSp, ΔHBS_20_MBSp and HBSMut_20_MBSp target RNAs were prepared by annealing synthetic antisense DNA oligonucleotides (Microsynth; for sequences, see Supplementary Table S2 ) to the T7 promoter sense oligonucleotode (T7s; Supplementary Table S2 ).

Techniques: In Vitro, Control, Comparison

Journal: Cell Reports

Article Title: No evidence of human genome integration of SARS-CoV-2 found by long-read DNA sequencing

doi: 10.1016/j.celrep.2021.109530

Figure Lengend Snippet:

Article Snippet: Oligo sequences are shown in . , Integrated DNA Technologies , N/A.

Techniques: Recombinant, Staining, Ligation, Sequencing, Infection, Software

Journal: Journal of Cellular and Molecular Medicine

Article Title: Autophagy promotes fibrosis and apoptosis in the peritoneum during long‐term peritoneal dialysis

doi: 10.1111/jcmm.13393

Figure Lengend Snippet: HPGDS induced Beclin 1‐dependent autophagy in human peritoneal mesothelial cells (HPMCs). ( A and B ) Transmission electron microscopy images of HPMCs following high‐glucose peritoneal dialysis solution (HGPDS) treatment. The HPMCs were treated with 4.25% HGPDS or vehicle for 24 hrs. Cells were then fixed immediately in 1% glutaraldehyde and post‐fixed in 2% osmium tetroxide. The cell pellets or sections were embedded in Epon resin. Representative areas were picked for ultrathin sectioning. Transmission electron microscopy is performed using a Tecnai G2 Spirit Bio TWIN (FEI Co.) at 120 kV. ( A ) The HPMCs were treated with vehicle as control (a) and 4.25% HGPDS for 24 hrs (b). Scale bars: 2 μm. ( B ) Cells treated with vehicle as a control with normal nuclear and organelles. N: nuclear; M: mitochondrion; ER: endoplasmic reticulum. Scale bars: 500 nm (a). Cells are treated with 4.25% HGPDS for 24 hrs. N: nuclear; White arrows, representative autophagic structures; Yellow arrows, degradative autophagic vacuoles. Scale bars: 1 μm (b, c and d), 500 nm (e and f). ( C ) Western blotting analysis shows the effect of 4.25% HPGDS treatment of cells transfected with siRNA Beclin 1 or siRNA Ctrl on MAP‐LC3 lipidation and p62/SQSTM1 expression. ( D ) Western blotting analysis shows the effect of 4.25% HPGDS treatment of cells cotreated with TGF‐β1 (10 ng/ml) on MAP‐LC3 lipidation and p62/SQSTM1 expression. ( E ) and ( F ) HPMCs pre‐treated with TGF‐β1 (10 ng/ml) or transfected with siRNA Beclin1 were treated with 4.25% HGPDS or vehicle for 24 hrs. Cells were then probed by SNLYSO sensor (an autolysosome florescent probe), and autophagic cells were analysed and quantitated by flowcytometer. Results from three independent experiments are shown as means ± S.D. ** P < 0.01, * P < 0.05 versus untreated control group. ## P < 0.01 versus 4.25% HGPDS‐treated group.

Article Snippet: The human Beclin‐1 siRNA oligonucleotides (Sequence 1: sense 5′‐AAGAUUGAAGACACAGGAGGC‐3′, antisense 5′‐GCCUCCUGUGUCUUCAAUCUU‐3′; Sequence 2: sense 5′‐CAGUUUGGCACAAUCAAUA‐3′, antisense 5′‐UAUUGAUUGUGCCAAACUG‐3′) were synthesized by GenePharma, Inc. (Pudong, Shanghai).

Techniques: Transmission Assay, Electron Microscopy, Control, Western Blot, Transfection, Expressing

Journal: Journal of Cellular and Molecular Medicine

Article Title: Autophagy promotes fibrosis and apoptosis in the peritoneum during long‐term peritoneal dialysis

doi: 10.1111/jcmm.13393

Figure Lengend Snippet: Autophagy inhibition rescued apoptosis in human peritoneal mesothelial cells. ( A and B ) Human peritoneal mesothelial cells pre‐treated with TGF‐β1 (10 ng/ml) or transfected with siRNA Beclin1 were treated with 4.25% high‐glucose peritoneal dialysis solution (HGPDS) or vehicle for 24 hrs. The sum of early and late apoptotic cells ratio (%) was quantitated by flowcytometer analysis of Annexin V/PI. Results from three independent experiments are shown as means ± S.D. Results from three independent experiments are shown as means ± S.D. ** P < 0.01, * P < 0.05 versus untreated control group. ## P < 0.01, # P < 0.05 versus 4.25% HGPDS‐treated group. ( C and D ) Human peritoneal mesothelial cells transfected with siRNA Beclin1 were treated with 4.25% HGPDS or vehicle for 24 hrs. The apoptosis‐related protein such as Bax, Bcl‐2, Mcl‐1, PARP, caspase‐3 and caspase‐8 was assessed by Western blotting assay. GAPDH was used as loading control.

Article Snippet: The human Beclin‐1 siRNA oligonucleotides (Sequence 1: sense 5′‐AAGAUUGAAGACACAGGAGGC‐3′, antisense 5′‐GCCUCCUGUGUCUUCAAUCUU‐3′; Sequence 2: sense 5′‐CAGUUUGGCACAAUCAAUA‐3′, antisense 5′‐UAUUGAUUGUGCCAAACUG‐3′) were synthesized by GenePharma, Inc. (Pudong, Shanghai).

Techniques: Inhibition, Transfection, Control, Western Blot

Journal: Science Advances

Article Title: 5′ Half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos

doi: 10.1126/sciadv.abh0494

Figure Lengend Snippet: ( A ) Illustration of 5′tRFl-MO target region. ( B ) 5′tRFl Gly/GCC and 5′tRFl Glu/CTC MOs did not affect translation activity in the RRL in vitro translation system. Left: The experimental procedure. The synthesized and exogenous proteins were immunoblotted with anti-GFP and anti-mCherry antibody, respectively. Right top: Western blot results with short exposure (S. exp) or long exposure (L. exp). Bottom: The relative GFP/mCherry ratio quantified from band intensity. Data are shown in averages with ±SD from three independent experiments. ns, nonsignificant with P > 0.05 (Student’s t test, two-tailed). ( C ) Northern blot results of tRNA Glu/CTC (top) and tRNA Gly/GCC (bottom) from the RRL system with the addition of different MOs using antisense LNA probes. ( D ) Experimental procedure for detection of the tRNA/MO complex by Northern blotting. ( E and F ) Estimation of MO binding capacity in vivo with tRNA Glu/CTC (E) or tRNA Gly/GCC (F). Each blot was subjected to short or/and long exposure after hybridization. S, 1.2 ng of in vitro synthesized full-length tRNA and 1.2 ng of 5′tRFl-mimetic that were directly loaded onto gel; S + MO, preannealed synthetic tRNA (1.2 ng)/5′tRFl (1.2 ng) and MO (1.5 ng); other lanes in right, MO injection at 10 ng per embryo. The possible composition of each band after GelSafe staining is indicated by arrows. Note that 5′tRFl Glu/CTC -MO/tRNA Glu/CTC was undetectable, suggesting that they do not bind to each other. Weak 5′tRFl Gly/GCC -MO/tRNA Gly/GCC complex (indicated by a blue arrow) was detected and is quantified in the bar graph on the left. 5′tRFl Gly/GCC /5′tRFl Gly/GCC -MO or 5′tRFl Glu/CTC /5′tRFl Glu/CTC -MO complex is indicated by a red arrow.

Article Snippet: Biotin-labeled antisense DNA oligos were linked to streptavidin beads (Thermo Fisher Scientific, 11206D).

Techniques: Activity Assay, In Vitro, Synthesized, Western Blot, Two Tailed Test, Northern Blot, Binding Assay, In Vivo, Hybridization, Injection, Staining

Journal: Science Advances

Article Title: 5′ Half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos

doi: 10.1126/sciadv.abh0494

Figure Lengend Snippet: ( A ) Sequence comparison between zebrafish ( Danio rerio , Dr) and yeast ( Saccharomyces cerevisiae , Sc) tRNA Gly/GCC or tRNA Glu/CTC . The mismatched bases are boxed. The MO-targeted sequences are indicated by arrows. ( B ) Procedures for in vitro tRNA transcription using the T7 RNA polymerase and subsequent purification and refolding. RT, room temperature. ( C ) Disability of 5′tRFl Gly/GCC -MO binding to Sc-tRNA Gly/GCC in zebrafish embryos as detected by Northern blotting. Ten nanograms of 5′tRFl Gly/GCC -MO and/or 800 pg of tRNA Gly/GCC (per embryo) was injected into 1c stage embryos, and embryos were harvested at 2.5 hpf for extraction of total RNAs. Synthetic tRNA Gly/GCC was directly loaded onto the gel, serving as molecular markers. RNAs on blots were probed using digoxigenin-labeled antisense Sc-tRNA Gly/GCC oligo (left bottom) or antisense Dr-tRNA Gly/GCC -LNA oligo (right bottom). The endogenous Dr-tRNA Gly/GCC /5′tRFl Gly/GCC -MO complex is indicated by a red arrow (right bottom). ( D ) Sc-tRNA Gly/GCC rescues the lethal phenotype of 5′tRFl Gly/GCC morphants. ( E ) Procedure for isolation of native Dr-tRNA Glu/CTC and Sc-tRNA Glu/CTC . The starting material was purchased yeast crude tRNA extracts or total tRNAs extracted from zebrafish embryos. Biotin-labeled antisense Sc-tRNA Glu/CTC or Dr-tRNA Glu/CTC oligo was used to pull-down specific tRNA Glu/CTC molecules, which were enriched by streptavidin beads. The isolated tRNA Glu/CTC molecules were subjected to gel separation, gel cut (boxed), elution, and refolding. ( F ) Effective rescue of 5′tRFl Glu/CTC morphants by native Dr-tRNA Glu/CTC but not Sc-tRNA Glu/CTC . 5′tRFl Glu/CTC -MO (1.25 ng per embryo) alone or together with purified native Dr- or Sc-tRNA Glu/CTC (1.6 ng per embryo) was injected into 1c stage embryos, followed by morphological observation at 24 hpf. The ratio of embryos with the representative morphology is indicated. Scale bars, 100 μm (for embryos).

Article Snippet: Biotin-labeled antisense DNA oligos were linked to streptavidin beads (Thermo Fisher Scientific, 11206D).

Techniques: Sequencing, In Vitro, Purification, Binding Assay, Northern Blot, Injection, Labeling, Isolation

Journal: The Journal of Neuroscience

Article Title: The Involvement of Glucose Metabolism in the Regulation of Inducible Nitric Oxide Synthase Gene Expression in Glial Cells: Possible Role of Glucose-6-Phosphate Dehydrogenase and CCAAT/Enhancing Binding Protein

doi: 10.1523/JNEUROSCI.23-20-07470.2003

Figure Lengend Snippet: The effect of extracellular glucose concentration on the intracellular NADPH/NADP+ ratio and the possible role of G6PD in glucose-mediated upregulation of LPS-induced iNOS gene expression in C6 rat glioma cells. The C6 cells were treated with various glucose concentrations (0, 1, 3, and 6 gm/l) for 36 hr or DHEA (100 μm) plus 6 gm/l glucose for 0.5 hr before treatment with LPS (2 μg/ml) and then were harvested for measurement of NADPH and NADP+ levels as described in Materials and Methods (A). Each concentration of NADPH and NADP+ was normalized with total protein quantity. The effect of indexed concentrations of DHEA (0, 10, 50, and 100 μm) on nitrite production and on iNOS protein and its mRNA levels was examined in the presence or absence of LPS (B). The iNOS mRNA levels were measured after 6 hr of LPS treatment. Nitrite and iNOS protein were measured after 24 hr of LPS treatment. Cyclophilin (CPN) was used as an internal standard in Northern blot analysis. For the knockdown of G6PD the cells were transfected with glucose 6-phosphate dehydrogenase (G6PD) antisense DNA oligomer or its sequence-scrambled DNA oligomer as described in Materials and Methods (C). At 2 d after transfection the cells were stimulated with LPS, and NO production and the protein levels of iNOS and G6PD were measured. The error bars in each panel indicate the SEM (*p < 0.05, **p < 0.01, and ***p < 0.001 as compared with 0 gm/l of the glucose-treated group).

Article Snippet: At 80% of confluency the G6PD antisense DNA oligomer (5′-AAG-CCA-CCTGCT-CTG-CCA-TG-3′), which has an equivalent location to -1 to ∼19 of rat G6PD cDNA sequence ( Ho et al., 1988 ), and its sequence-scrambled oligomer (5′-GCC-TAC-ATA-CGA-GCC-TTG-AC-3′) were transfected by using Oligofectamin (Invitrogen, San Diego, CA) according to the manufacturer's instructions.

Techniques: Concentration Assay, Gene Expression, Northern Blot, Knockdown, Transfection, Sequencing